Shopping security
CD70 Recombinant Protein
Catalogue Number: NCP0224-500, NCP0224-1000
Sizes: 500ug, 1mg
Swiss-Prot: P32970
Host: E.coli
Tag: His-tag
AA Sequence: CAGCGCTTCGCACAGGCACAGCAGCAGCTGCCGCTGGAAAGTCTGGGTTGGGATGTGGCAGAACTGCAGCTGAATCATACCGGCCCGCAGCAGGATCCGCGTCTGTATTGGCAGGGCGGCCCGGCTCTGGGTCGTAGCTTCCTGCATGGTCCGGAACTGGATAAAGGCCAGCTGCGCATTCATCGTGATGGTATCTATATGGTTCATATTCAGGTGACCCTGGCAATCTGTAGCAGTACCACCGCAAGTCGCCATCATCCGACCACCCTGGCAGTTGGTATCTGTAGTCCGGCCAGCCGTAGCATTAGCCTGCTGCGTCTGAGCTTCCATCAGGGCTGTACCATTGCAAGTCAGCGCCTGACCCCGCTGGCACGTGGCGATACCCTGTGCACCAATCTGACCGGTACCCTGCTGCCGAGTCGTAATACCGATGAAACCTTCTTCGGTGTGCAGTGGGTGCGTCCG
Restriction Sites: NdeI-XhoI
Background: CD70 is a type II transmembrane glycoprotein and a member of the tumor necrosis factor ligand superfamily (TNFSF), also known as CD27L and TNFSF7. It is normally expressed on medullary thymic epithelial cells. Its expression is induced on activated lymphoid cells (B cells, T cells, and NK cells) and dendritic cells. CD70 is a ligand for CD27, a co-stimulatory receptor that plays an important role in T cell activation and proliferation. CD70 overexpression has been reported in various tumors such as renal cell carcinoma, glioblastoma, and non-small cell lung carcinoma and it’s being actively pursued as a therapeutic target.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~17kDa
Notes: For research use only, not for use in diagnostic procedure.
Ships within 48 hours · Estimated delivery Sep 24 - Sep 29
US$40
Get nowSign up to your membership to get coupons up to
15%
Get nowOpportunity to enjoy order discount up to 15% off
Top-Converting Item to Boost Your Average Order