Shopping security
CD59 Recombinant Protein
Catalogue Number: NCP0217-500, NCP0217-1000
Sizes: 500ug, 1mg
Swiss-Prot: P13987
Host: E.coli
Tag: His-tag
AA Sequence: CTGCAGTGTTATAATTGTCCGAATCCGACCGCAGATTGTAAAACCGCCGTGAATTGTAGTAGTGACTTCGATGCATGTCTGATTACCAAAGCAGGCCTGCAGGTGTATAATAAATGCTGGAAATTCGAACATTGCAACTTCAATGATGTTACCACCCGCCTGCGCGAAAATGAACTGACCTATTATTGCTGTAAAAAGGATCTGTGCAACTTCAACGAACAGCTGGAAAAT
Restriction Sites: NdeI-XhoI
Background: CD59 is a GPI-anchored membrane protein that functions as inhibitor of the complement membrane attack complex (MAC). CD59 binds to complement components C8 and C9, preventing C9 polymerization and insertion into membranes, therefore inhibiting the complement-dependent cytolysis (CDC). CD59 is a ubiquitously expressed cell membrane protein that protects cells from CDC. Rare cases of CD59 deficiency have been reported to cause paroxysmal nocturnal hemoglobinuria in human patients. Expression of CD59 on tumor cells and viral infected cells makes them resist antibody-dependent complement-mediated lysis. Potent inhibitors for CD59 have been actively pursued for therapeutic applications. In addition, CD59 may regulate insulin secretion by modulating exocytosis.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~9kDa
Notes: For research use only, not for use in diagnostic procedure.
Ships within 48 hours · Estimated delivery Sep 24 - Sep 29
US$40
Get nowSign up to your membership to get coupons up to
15%
Get nowOpportunity to enjoy order discount up to 15% off
Top-Converting Item to Boost Your Average Order