20% OFF shipping at www.lodomez-construction.com on orders over $79 + up to 10% OFF products
www.lodomez-construction.com
home > CD107a/LAMP1 Recombinant Protein - NCP0245 > CD107a/LAMP1 Recombinant Protein - NCP0245
download picture
CD107a/LAMP1 Recombinant Protein - NCP0245CD107a LAMP1 Recombinant Protein Catalogue Number: NCP0245 500, NCP0245 1000 Sizes: 500ug, 1mg Swiss Prot: P11279 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD107a/LAMP1 Recombinant Protein

Catalogue Number: NCP0245-500, NCP0245-1000

Sizes: 500ug, 1mg

Swiss-Prot: P11279

Host: E.coli

Tag: His-tag

AA Sequence: GCAATGTTCATGGTGAAAAATGGCAATGGTACCGCATGCATTATGGCCAACTTCAGTGCCGCATTCAGTGTTAATTATGATACCAAAAGCGGTCCGAAAAATATGACCTTCGATCTGCCGAGCGATGCAACCGTGGTTCTGAATCGCAGCAGTTGTGGCAAAGAAAATACCAGCGATCCGAGCCTGGTGATTGCATTCGGTCGTGGTCATACCCTGACCCTGAACTTCACCCGTAATGCCACCCGTTATAGTGTGCAGCTGATGAGCTTCGTGTATAATCTGAGTGATACCCATCTGTTCCCGAATGCAAGTAGCAAAGAAATTAAAACCGTTGAAAGTATCACCGATATTCGTGCAGATATTGATAAAAAATACCGCTGCGTGAGTGGTACCCAGGTGCACATGAATAATGTGACCGTTACCCTGCATGATGCCACCATTCAGGCATATCTGAGTAATAGTAGCTTCAGCCGCGGCGAAACCAGATGTGAACAGGATCGCCCGAGTCCGACCACCGCACCGCCTGCACCTCCGTCACCGAGTCCGAGCCCGGTTCCGAAAAGCCCGAGTGTGGATAAATATAATGTTAGCGGTACCAATGGTACCTGCCTGCTGGCAAGTATGGGCCTGCAGCTGAATCTGACCTATGAACGTAAAGATAATACCACCGTGACCCGTCTGCTGAATATTAATCCGAATAAAACCAGCGCCAGCGGTAGCTGTGGTGCACATCTGGTGACCCTGGAACTGCATAGTGAAGGTACCACCGTGCTGCTGTTCCAGTTCGGTATGAATGCAAGTAGTAGCCGCTTCTTCCTGCAGGGTATTCAGCTGAATACCATTCTGCCGGATGCACGCGATCCGGCCTTCAAAGCAGCCAATGGCAGCCTGCGCGCACTGCAGGCAACCGTTGGCAATAGCTATAAATGCAATGCCGAAGAACATGTGCGCGTTACCAAAGCATTCAGCGTTAATATCTTCAAAGTGTGGGTTCAGGCATTCAAAGTTGAAGGCGGTCAGTTCGGTAGTGTTGAAGAATGCCTGCTGGATGAAAATAGCATG

Restriction Sites: NdeI-XhoI

Background: Lysosome-associated membrane protein 1 and 2 (LAMP1 and LAMP2) are two abundant lysosomal membrane proteins. Both are transmembrane proteins and are heavily glycosylated at the amino-terminal luminal side of the lysosomal inner leaflet, which protects the proteins from proteolysis. The carboxy terminus of LAMP1 is exposed to the cytoplasm and contains a tyrosine sorting motif that targets LAMP to lysosomal membranes. LAMP1 and LAMP2 are 37% homologous in their protein sequences. Both LAMP1 and LAMP2 are involved in regulating lysosomal motility during lysosome-phagosome fusion and cholesterol trafficking.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~37kDa

Notes: For research use only, not for use in diagnostic procedure.

CD107a/LAMP1 Recombinant Protein - NCP0245

Item no : 50638972648
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Sep 24 - Sep 29

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches