20% OFF shipping at www.lodomez-construction.com on orders over $79 + up to 10% OFF products
www.lodomez-construction.com
home > CD1C Recombinant Protein - NCP0187 > CD1C Recombinant Protein - NCP0187
download picture
CD1C Recombinant Protein - NCP0187CD1C Recombinant Protein Catalogue Number: NCP0187 500, NCP0187 1000 Sizes: 500ug, 1mg Swiss Prot: P29017 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD1C Recombinant Protein

Catalogue Number: NCP0187-500, NCP0187-1000

Sizes: 500ug, 1mg

Swiss-Prot: P29017

Host: E.coli

Tag: His-tag

AA Sequence: AACGCCGATGCCAGTCAGGAACATGTGAGCTTCCATGTTATTCAGATCTTCAGCTTCGTTAATCAGAGCTGGGCACGTGGTCAGGGTAGCGGTTGGCTGGATGAACTGCAGACCCATGGCTGGGATAGTGAAAGCGGCACCATTATCTTCCTGCATAATTGGAGCAAAGGTAACTTCAGTAATGAAGAACTGAGTGATCTGGAACTGCTGTTCCGCTTCTATCTGTTCGGCCTGACCCGCGAAATTCAGGATCATGCCAGTCAGGATTATAGCAAATATCCGTTCGAAGTTCAGGTTAAAGCCGGCTGCGAACTGCATAGCGGTAAAAGCCCGGAAGGCTTCTTCCAGGTTGCATTCAATGGCCTGGATCTGCTGAGCTTCCAGAATACCACCTGGGTTCCGAGTCCGGGTTGTGGCAGTCTGGCACAGAGCGTGTGTCATCTGCTGAATCATCAGTATGAAGGTGTTACCGAAACCGTGTATAATCTGATTCGTAGCACCTGCCCGCGCTTCCTGCTGGGTCTGCTGGATGCAGGCAAAATGTATGTGCATCGTCAGGTGCGCCCGGAAGCCTGGCTGAGTAGCCGCCCTAGCCTGGGCAGTGGCCAGCTGCTGCTGGTGTGTCATGCAAGTGGCTTCTATCCGAAACCGGTGTGGGTTACCTGGATGCGTAATGAACAGGAACAGCTGGGTACCAAACATGGCGATATTCTGCCGAATGCAGATGGTACCTGGTATCTGCAGGTTATTCTGGAAGTGGCCAGCGAAGAACCGGCCGGTCTGAGCTGTCGCGTGCGTCATAGCAGTCTGGGTGGCCAGGATATTATTCTGTATTGGGGTCATCACTTCAGCATG

Restriction Sites: NdeI-XhoI

Background: The CD1 multigene family encodes five forms of the CD1 T-cell surface glycoprotein in human, designated CD1A, 1B, 1C, 1D and 1E. CD1, a type 1 membrane protein, has structural similarity to the MHC class I antigen and has been shown to present lipid antigens for recognition by T lymphocytes. CD1 antigens are associated with β-2-Microglobulin and expressed on cortical thymocytes, Langerhans cells, a B cell subset and some dendritic cells. Specifically, CD1A is a marker for Langerhans cell histiocytosis (LCH) and is found on interdigitating cells. Adaptor-protein complexes and CD1-associated chaperones control CD1 trafficking, and the development and activation of CD1-restricted T cells. Constitutive endocytosis of CD1B molecules and the differential sorting of MHC class II from lysosomes separate peptide- and lipid antigen-presenting molecules during dendritic cell maturation. CD1B is also expressed in interdigitating cells. The human CD1 genes are all closely linked in a cluster mapping at chromosome 1q23.1.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~31kDa

Notes: For research use only, not for use in diagnostic procedure.

CD1C Recombinant Protein - NCP0187

Item no : 36160884069
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Sep 24 - Sep 29

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches