CD32 (FcgammaRIIb) Recombinant Protein

Catalogue Number: NCP0200-500, NCP0200-1000

Sizes: 500ug, 1mg

Swiss-Prot: P31994

Host: E.coli

Tag: His-tag

AA Sequence: ACCCCTGCTGCACCGCCTAAAGCAGTGCTGAAACTGGAACCGCAGTGGATTAATGTTCTGCAGGAAGATAGTGTGACCCTGACCTGCCGCGGCACCCATAGTCCGGAAAGTGATAGTATTCAGTGGTTCCATAATGGCAATCTGATTCCGACCCATACCCAGCCGAGTTATCGCTTCAAAGCCAATAATAATGATAGTGGCGAATATACCTGCCAGACCGGTCAGACCAGCCTGAGCGATCCGGTGCATCTGACCGTTCTGAGCGAATGGCTGGTTCTGCAGACCCCGCATCTGGAATTCCAGGAAGGTGAAACCATTGTGCTGCGCTGTCATAGCTGGAAAGATAAACCGCTGGTTAAAGTTACCTTCTTCCAGAATGGTAAAAGTAAAAAATTCAGCCGCAGCGATCCGAACTTCAGCATTCCGCAGGCCAATCATAGTCATAGCGGCGATTATCATTGCACCGGTAATATTGGTTATACCCTGTATAGCAGTAAACCGGTGACCATTACCGTGCAGGCCCCG

Restriction Sites: NdeI-XhoI

Background: FcγRIIB (CD32B) is a low affinity, IgG Fc-binding receptor expressed on B cells, monocytes, macrophages, and dendritic cells (DCs). It is the inhibitory Fc receptor and signals through an immunoreceptor tyrosine-based inhibitory motif (ITIM) within its carboxy-terminal cytoplasmic tail. Binding of immune complexes to FcγRIIB results in tyrosine phosphorylation of the ITIM motif at Tyr292 and recruitment of the phosphatase SHIP, which mediates inhibitory effects on immune cell activation. In this way, FcγRIIB suppresses the effects of activating Fc-binding receptors. For example, mice deficient for FcγRIIB have greater T cell and DC responses following injection of immune complexes . In addition, FcγRIIB plays a role in B cell affinity maturation. Signaling through FcγRIIB in the absence of signaling through the B cell receptor (BCR) is proapoptotic, while signaling through FcγRIIB and the BCR simultaneously attenuates the apoptotic signal and results in selection of B cells with higher antigen affinity.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~23kDa

Notes: For research use only, not for use in diagnostic procedure.