20% OFF shipping at www.lodomez-construction.com on orders over $79 + up to 10% OFF products
www.lodomez-construction.com
home > CD6 Recombinant Protein - NCP0218 > CD6 Recombinant Protein - NCP0218
download picture
CD6 Recombinant Protein - NCP0218CD6 Recombinant Protein Catalogue Number: NCP0218 500, NCP0218 1000 Sizes: 500ug, 1mg Swiss Prot: P30203 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD6 Recombinant Protein

Catalogue Number: NCP0218-500, NCP0218-1000

Sizes: 500ug, 1mg

Swiss-Prot: P30203

Host: E.coli

Tag: His-tag

AA Sequence: CATCCGAGTCCGGCACCGCCTGATCAGCTGAATACCAGCAGCGCAGAAAGTGAACTGTGGGAACCGGGTGAACGTCTGCCGGTGCGCCTGACCAATGGCAGCAGCAGTTGCAGCGGCACCGTGGAAGTGCGCCTGGAAGCAAGTTGGGAACCGGCATGCGGTGCCCTGTGGGATAGCCGTGCAGCCGAAGCCGTGTGCCGCGCACTGGGTTGTGGCGGTGCAGAAGCCGCCAGCCAGCTGGCACCGCCTACCCCTGAACTGCCGCCGCCTCCTGCCGCTGGTAATACCAGCGTTGCAGCAAATGCAACCCTGGCAGGCGCACCGGCACTGCTGTGCAGTGGCGCAGAATGGCGTCTGTGCGAAGTTGTTGAACATGCATGTCGCAGTGATGGTCGCCGTGCCCGCGTTACCTGTGCCGAAAATCGTGCCCTGCGTCTGGTGGATGGCGGTGGCGCATGCGCAGGTCGTGTTGAAATGCTGGAACATGGCGAATGGGGCAGTGTGTGTGATGATACCTGGGATCTGGAAGATGCACATGTTGTGTGTCGCCAGCTGGGCTGTGGCTGGGCCGTGCAAGCCCTGCCTGGTCTGCACTTCACCCCGGGTCGTGGCCCGATTCATCGCGATCAGGTTAATTGCAGCGGTGCAGAAGCATATCTGTGGGATTGTCCGGGTCTGCCGGGCCAGCATTATTGTGGCCATAAAGAAGATGCAGGTGCCGTGTGCAGTGAACATCAGAGCTGGCGTCTGACCGGTGGTGCCGATCGCTGCGAAGGCCAGGTTGAAGTTCACTTCCGCGGCGTGTGGAATACCGTGTGCGATAGCGAATGGTATCCGAGCGAAGCCAAAGTGCTGTGCCAGAGTCTGGGTTGCGGTACCGCCGTGGAACGTCCGAAAGGTCTGCCGCATAGTCTGAGTGGTCGCATGTATTATAGCTGTAATGGTGAAGAACTGACCCTGAGCAATTGTAGCTGGCGCTTCAATAATAGTAATCTGTGCAGCCAGAGTCTGGCCGCACGCGTTCTGTGCAGCGCCAGTCGCAGCCTGCATAATCTGAGTACCCCGGAAGTTCCGGCCAGTGTTCAGACCGTGACCATTGAAAGTAGTGTGACCGTTAAAATTGAAAATAAGGAAAGCCGCGAACTGATGCTG

Restriction Sites: NdeI-XhoI

Background: T cell differentiation antigen CD6 is a cell adhesion molecule expressed on immature thymocytes and mature T cells, and has also been detected on a subset of B cells and NK cells within the immune system. CD6 mediates cell-cell interactions through it’s binding partner CD166/ALCAM, and contributes to the formation and maturation of the immunological synapse. CD6 functions as a co-stimulatory receptor, promoting T cell activation and proliferation through the TCR/CD3 complex signaling cascade. Studies have shown CD6 can be glycosylated, hyperphosphorylated on serine and threonine residues, and phosphorylated on tyrosine residues, each of which can differentially effect the function and signaling of this molecule. CD6 also functions as a calcium-dependent pattern receptor that binds and aggregates Gram-positive and Gram-negative bacteria. In response to lipopolysaccharide, CD6 mediates activation of the inflammatory response and secretion of pro-inflammatory cytokines.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~44kDa

Notes: For research use only, not for use in diagnostic procedure.

CD6 Recombinant Protein - NCP0218

Item no : 17287543010
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Sep 25 - Sep 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Related Searches